View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_42 (Length: 276)
Name: NF8261_low_42
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 106 - 204
Target Start/End: Complemental strand, 38053981 - 38053893
Alignment:
| Q |
106 |
ttattcctatgggcatcggtgagatttttccctcaaagagaaagataaaatataaagaaaatgagagattgagatttacggtggagattgttgcacata |
204 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053981 |
ttattcctatggacattggtgagatttttccctcaaa----------aaatataaagaaaatgagagattgagatttacggtggagattgttgcacata |
38053893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 38054507 - 38054464
Alignment:
| Q |
1 |
aattatgagtttgatgtgtgaattatgttacatgtatagttggc |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38054507 |
aattatgagtttgatgtgtgaattctgttacatgtatagttggc |
38054464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 76 - 112
Target Start/End: Complemental strand, 38054409 - 38054373
Alignment:
| Q |
76 |
atggtaggttgacagtgagattcgcatgaattattcc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054409 |
atggtaggttgacagtgagattcgcatgaattattcc |
38054373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 38053876 - 38053844
Alignment:
| Q |
222 |
agaatttcatgtaaaagaatacattcccaatta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38053876 |
agaatttcatgtaaaagaatacattcccaatta |
38053844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University