View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_44 (Length: 255)
Name: NF8261_low_44
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 40 - 237
Target Start/End: Complemental strand, 7423167 - 7422969
Alignment:
| Q |
40 |
ttatgttcaagacttcaagtcatataagatagcaaaagaaaaatgcaaaatattaataagcatacgtc-gcttgatttaacacttcatgcgagcagacag |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7423167 |
ttatgttcaagacttcaagtcatataagatagcaaaagaaaaatgcaaaatattaataagcatacgtcagcttgatttaacacttcatgcgagcagacag |
7423068 |
T |
 |
| Q |
139 |
atggttgtgattggctcttgttcgagggccataatccatgtactgtgaatattttggggagtgtggtggatatgcatttgatttttggatccttgcaaa |
237 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7423067 |
atggttgtgattggcccttgttcgagggccataatccatgtactgtgaatattttggggagtgtggtggatatgcatttgatttttggatccttgcaaa |
7422969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University