View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_45 (Length: 254)
Name: NF8261_low_45
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 30055205 - 30055025
Alignment:
| Q |
19 |
agcatcttccaacccttagattaacttccaaacccttcaactccatccacactttcaccgaatcactctctcgaatcctgtctcttcgcgatgattccac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055205 |
agcatcttccaacccttagattaacttccaaacccttcaactccatccacactttcaccgaatcactctctcgaatcctgtctcttcgcgatgattccac |
30055106 |
T |
 |
| Q |
119 |
tccactccacactctcgagtttcttgacaaagaggtttccgtggaaccccgaatactgaatagtatcgtagaatacgctgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055105 |
tccactccacactctcgagtttcttgacaaagaggttttcgtggaaccccgaatactgaatagtatcgtagaatacgctgt |
30055025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 226 - 254
Target Start/End: Complemental strand, 30055011 - 30054983
Alignment:
| Q |
226 |
ttccatcttgcttattttcatctcaaact |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30055011 |
ttccatcttgcttattttcatctcaaact |
30054983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University