View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_46 (Length: 253)
Name: NF8261_low_46
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 34697313 - 34697109
Alignment:
| Q |
18 |
acatcaaccaaatgaagccatgaacattgcacacgtccatgagatattatagaacataaccataccccgtgcgt-acattctgggtgtgcgcacacgcgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||| |||| |
|
|
| T |
34697313 |
acatcaaccaaatgaagccatgaacattgcacacgtccatgagatattatagaacataaccataccccgtgctttaaattctgggtgtgcgcacgggcgc |
34697214 |
T |
 |
| Q |
117 |
ccacacaaacacatgtaaatattgatatatattatgtccaaaccttctgttttttaagaagggactataggaaatttagagtttgacacataagtaaagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34697213 |
ccacacaaacacatgtaaatattgatatatattttgtccaaaccttctgttttttaagaagggactataggtaatttagagtttgacacataagtaaagt |
34697114 |
T |
 |
| Q |
217 |
ttgat |
221 |
Q |
| |
|
||||| |
|
|
| T |
34697113 |
ttgat |
34697109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University