View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_48 (Length: 248)
Name: NF8261_low_48
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 46 - 233
Target Start/End: Original strand, 43409955 - 43410142
Alignment:
| Q |
46 |
gttgcaggatatgaggagaaactagaaattaagactgctgagttatcaaactttcttgatatgatgagaagtgcttctgcagatgaaagtggaggattta |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409955 |
gttgcaggatatgaggagaaactagaaattaagactgccgagttatcaaactttcttgatatgatgagaagtgcttctgcagatgaaagtggaggattta |
43410054 |
T |
|
| Q |
146 |
gcacatcaaggactgattggaaagtaggttatttactctataatttttacgaagttatgttttatttttatccaattgataacttcat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410055 |
gcacatcaaggactgattggaaagtaggttatttactctataatttttacgaagttatgttttatttttatccaattgataacttcat |
43410142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University