View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8261_low_53 (Length: 232)
Name: NF8261_low_53
Description: NF8261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8261_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 22 - 127
Target Start/End: Original strand, 37879639 - 37879744
Alignment:
| Q |
22 |
ccgcaagcagaaaaaccttcatcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879639 |
ccgcaagcagaaaaaccttcatcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacat |
37879738 |
T |
 |
| Q |
122 |
cgtcaa |
127 |
Q |
| |
|
|||||| |
|
|
| T |
37879739 |
cgtcaa |
37879744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University