View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8262_high_3 (Length: 406)
Name: NF8262_high_3
Description: NF8262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8262_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 145 - 395
Target Start/End: Complemental strand, 25882956 - 25882705
Alignment:
| Q |
145 |
taagaagtgagagaaccatatgggaacagctcgcataaagatgtggggaaagataatacacttcagagaatcagatgctcattgaagtttcattttggca |
244 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882956 |
taagaagtgagagaaccatatgggagcagctcgcataaagatgtggggaaagataatacacttcagagaatcagatgctcattgaagtttcattttggca |
25882857 |
T |
|
| Q |
245 |
atgaaggaggtttaatgctcatatggatttgtctttctgatgtattcttccatggttggcagtctaaagtggtttggtatttgctcatcattatattgat |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25882856 |
atgaaggaggtttaatgctcatatggatttgtctttctgatgtattcctccatggttggcagtctaaagtgatttggtatttgctcatcattatattgat |
25882757 |
T |
|
| Q |
345 |
-gagcttgggaaagggagttttttgcataatctttcgaccttttcatctcac |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25882756 |
ctcgcttgggaaagggagttttttgcataatctttcgaccttttcatatcac |
25882705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 25883029 - 25882954
Alignment:
| Q |
20 |
cttatagactcatcttgcattttcctaagaccaaccaagcgcactaagctttcctgagttatcctccttgtagtaa |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25883029 |
cttatagactcatcttgcattttcctaagaccaaccaagcgcactaagctttcctgagttatcctccttgtagtaa |
25882954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University