View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8262_high_5 (Length: 300)
Name: NF8262_high_5
Description: NF8262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8262_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 47707852 - 47708121
Alignment:
| Q |
18 |
cttggtttggctcctatgataagctataataataattagtagtacaaaggaattagggaatgggaagagagagatgtcatgggcatgggggattgttgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47707852 |
cttggtttggctcctatgataagctataataataattagtagtacaaaggaattagggaatgggaagagagagatgtcatgggcatgggggattgttgaa |
47707951 |
T |
|
| Q |
118 |
attaat----------------gctaacataacatatgagaatgaccaagct----agctataaccctttagagaagacaagctcacttctcatggttgg |
197 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47707952 |
attaattaatactcctatatatgctaacataacatatgagaatgaccaagctagctagctataaccctttagagaagacaagctcacttctcatggttgg |
47708051 |
T |
|
| Q |
198 |
ttaagaatagttggttaatgtttcatgaaatgttttttgaatgaggtcatgggggaggcacttaattgtg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47708052 |
ttaagaatagttggttaatgtttcatgaaacgttttttgaatgaggtcatgggggaggcacttaattgtg |
47708121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University