View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8262_low_8 (Length: 239)

Name: NF8262_low_8
Description: NF8262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8262_low_8
NF8262_low_8
[»] chr1 (1 HSPs)
chr1 (26-224)||(39828501-39828699)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 26 - 224
Target Start/End: Complemental strand, 39828699 - 39828501
Alignment:
26 atagctgataagccagtggtgatatttagcaagagcggttgttgcatgggggattctgtgaaagctctgataagaagctttggtgccaactctacagtta 125  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39828699 atagctgataagccagtggtgatatttagcaagagcagttgttgcatgggggattctgtgaaagctctgataagaagctttggtgccaactctacagtta 39828600  T
126 ttgagattgacaaaatggtaaatggtgagaaaatagaaagtgcattggttcagcttggttgtcgaccaagtgtgccagctgtgtttataggacaacaat 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39828599 ttgagattgacaaaatggtaaatggtgagaaaatagaaagtgcattggttcagcttggttgtcgaccaagtgtgccagctgtgtttataggacaacaat 39828501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University