View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8262_low_8 (Length: 239)
Name: NF8262_low_8
Description: NF8262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8262_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 26 - 224
Target Start/End: Complemental strand, 39828699 - 39828501
Alignment:
| Q |
26 |
atagctgataagccagtggtgatatttagcaagagcggttgttgcatgggggattctgtgaaagctctgataagaagctttggtgccaactctacagtta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39828699 |
atagctgataagccagtggtgatatttagcaagagcagttgttgcatgggggattctgtgaaagctctgataagaagctttggtgccaactctacagtta |
39828600 |
T |
 |
| Q |
126 |
ttgagattgacaaaatggtaaatggtgagaaaatagaaagtgcattggttcagcttggttgtcgaccaagtgtgccagctgtgtttataggacaacaat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39828599 |
ttgagattgacaaaatggtaaatggtgagaaaatagaaagtgcattggttcagcttggttgtcgaccaagtgtgccagctgtgtttataggacaacaat |
39828501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University