View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8262_low_9 (Length: 238)
Name: NF8262_low_9
Description: NF8262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8262_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 41777590 - 41777368
Alignment:
| Q |
1 |
tgttgctcacatcttccacctcttgcttgaacaaaactttgcggtttataagctaccaatttatatcttgcatgtggttcataaacaattgaggaatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777590 |
tgttgctcacatcttccacctcttgcttgaacaaaactttgcggtttataagctaccaatgtatatcttgcatgtggttcataaacaattgaggaatata |
41777491 |
T |
|
| Q |
101 |
ctactatccattatagcatttcttagcccctgcttgttttcacagtgtaggcaagttggacgtgcggtagttatgaagctacctcgtggagctgcgacat |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41777490 |
ctactatccattgtagcatttcttagcccctgcttgttttcacagtggaggcaagttggacgtgcggtagttatgaagctacctcgtggagctgcgacat |
41777391 |
T |
|
| Q |
201 |
cagcgcatattgggagtaacatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41777390 |
cagcgcatattgggagtaacatc |
41777368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University