View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8263_high_15 (Length: 218)

Name: NF8263_high_15
Description: NF8263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8263_high_15
NF8263_high_15
[»] chr2 (1 HSPs)
chr2 (14-206)||(37394748-37394940)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 37394940 - 37394748
Alignment:
14 cacttatgacggtgaataaattgataaataaccctgacttctggaaagaagttgtaccaggttataaatttacattgatatcgaaggctgaatttcctgg 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
37394940 cacttatgacggtgaataaattgataaataaccctgacttctggaaagaagttgtaccaggttataaatttacattgatatcaaaggctgaatttcctgg 37394841  T
114 taaagtgattgttcttaagtatatcaaattgaagggaacggcttacaatacatgtaacatcacggttaatatggcgccgggttcccatgatgt 206  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
37394840 taaagtgattgttcttaagtatatcaaattgaagggaacagcttacaatacatgtaacatcacggttaatatggcgccgggttcccatgatgt 37394748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University