View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8263_low_19 (Length: 237)

Name: NF8263_low_19
Description: NF8263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8263_low_19
NF8263_low_19
[»] chr3 (1 HSPs)
chr3 (1-237)||(36588138-36588374)


Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 36588374 - 36588138
Alignment:
1 caaaagacacgttacgatgacagtatttttgagaaggttttcatgactttgtttgcacgaaaaatggaaccatttgcagagcctgtaatagggaatgcta 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36588374 caaaagacacgttacaatgacagtatttttgagaaggttttcatgactttgtttgcacgaaaaatggaaccatttgcagagcctgtaatagggaatgcta 36588275  T
101 aaaagaagaaggaaaagaaaggttggttggatatttgggagtatgattatgagagttttgtggatgtgtcgaaaagagtaatgttgcgtcggtctcgttt 200  Q
    ||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||    
36588274 aaaagaagaaggaaaagaagggtttgttggatgtttgggagtatgattatgagagttttgttgatgtgtccaaaagagtaatgttgcgtcggtctcgttt 36588175  T
201 gcagcaacaacaagttgttcgtgaagttcttctttct 237  Q
    ||||||||| |||||||||||||| ||||||||||||    
36588174 gcagcaacagcaagttgttcgtgaggttcttctttct 36588138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University