View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8263_low_19 (Length: 237)
Name: NF8263_low_19
Description: NF8263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8263_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 36588374 - 36588138
Alignment:
| Q |
1 |
caaaagacacgttacgatgacagtatttttgagaaggttttcatgactttgtttgcacgaaaaatggaaccatttgcagagcctgtaatagggaatgcta |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36588374 |
caaaagacacgttacaatgacagtatttttgagaaggttttcatgactttgtttgcacgaaaaatggaaccatttgcagagcctgtaatagggaatgcta |
36588275 |
T |
 |
| Q |
101 |
aaaagaagaaggaaaagaaaggttggttggatatttgggagtatgattatgagagttttgtggatgtgtcgaaaagagtaatgttgcgtcggtctcgttt |
200 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36588274 |
aaaagaagaaggaaaagaagggtttgttggatgtttgggagtatgattatgagagttttgttgatgtgtccaaaagagtaatgttgcgtcggtctcgttt |
36588175 |
T |
 |
| Q |
201 |
gcagcaacaacaagttgttcgtgaagttcttctttct |
237 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
36588174 |
gcagcaacagcaagttgttcgtgaggttcttctttct |
36588138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University