View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8265_low_6 (Length: 228)
Name: NF8265_low_6
Description: NF8265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8265_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 2064485 - 2064278
Alignment:
| Q |
1 |
ttggatcgtttgagtattatgtagttgagccttcggaggtttcgtttacgcaagatcaccggagaagtgtttccgatcagaaagacattcacattccggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064485 |
ttggatcgtttgagtattatgtagttgagccttcggaggtttcgtttacgcaagatcaccggagaagtgtttccgatcagaaagacattcacattccggt |
2064386 |
T |
 |
| Q |
101 |
atcggaggattcatctatgacacatgaaaatactatcgctggtgaagttgctggaagtggacattggttgaaggattacgtggacagactatcggcttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064385 |
atcggaggattcatctatgacacatgaaaatactatcgctggtgaagttgctggaagtggacattggttgaaggattacgtggacagactatcggcttcg |
2064286 |
T |
 |
| Q |
201 |
atttcatc |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
2064285 |
atttcatc |
2064278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University