View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_high_10 (Length: 326)
Name: NF8266_high_10
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 14 - 307
Target Start/End: Complemental strand, 28209573 - 28209280
Alignment:
| Q |
14 |
gacatcaaggcatatgagatggtgtttgacgtgtatgttagtggaaacattggtgtgcaaattggtagtttgcatatggtcaacgtcccttttctttcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209573 |
gacatcaaggcatatgagatggtgtttgacgtgtatgttagtggaaacattggtgtgcaaattggtagtttgcatatggtcaacgtcccttttctttcat |
28209474 |
T |
 |
| Q |
114 |
cttgtgaacaaatcaaacaaatggatgtggattatggaagaaaacccgattgtgatatcaagatgttttcttacaggtacaattataaattgcttatata |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28209473 |
cttgtgaacaaatcaaacgaatggatgtggattatggaagaaaacccgattgtgatatcaagatgttttcttacaggtacaattataaattgcttatata |
28209374 |
T |
 |
| Q |
214 |
tatcatgtcattttgcatgcatcaattttggccgttaaatattccgaaatttgcatatttagttttgattaaactaagaggcttcaataaagat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28209373 |
tatcatgtcattttgcatgcatcaattttggccgttaaataatccgaaattttcatatttaattttgattaaactaagaggcttcaataaagat |
28209280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University