View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_high_17 (Length: 247)
Name: NF8266_high_17
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 18319889 - 18320121
Alignment:
| Q |
1 |
tttagggttgttgaatttactaaagagaaattgcatatgaatcataattattggacttataatatgcttttgagatcgctttgtgaaacgaatcatcatc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319889 |
tttagggttgttgaattcactaaagagaaattgcatatgaatcataattattggacttataatatgcttttgagatcgctttgtgaaacgaatcatcatc |
18319988 |
T |
|
| Q |
101 |
gttccgcgaaattggtttatgattggatgagatttgatgggcaggttcctgatagttggttgttagggtttttggtttcgtcctatgctttgatcggtag |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
18319989 |
gttccgcgaaattggtttacgattggatgagatttgatgggcaggttcctgatagttggttgttagggtttttggtttcgtcgtatgctttgattggtag |
18320088 |
T |
|
| Q |
201 |
attcgatgtttcgaaagagttgcttgttgatgt |
233 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
18320089 |
attcgatgtttcaaaagagttgcttgttgatgt |
18320121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University