View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_high_20 (Length: 239)
Name: NF8266_high_20
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 159 - 219
Target Start/End: Original strand, 38055466 - 38055526
Alignment:
| Q |
159 |
ttcaattactttcctatttcgacataatgtgcttcgattacttgacaaattgaaaacattt |
219 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38055466 |
ttcaattacttttctatttcgacataatgtgcttcgattacttgacaaattgaaaacattt |
38055526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 126
Target Start/End: Original strand, 38055442 - 38055479
Alignment:
| Q |
89 |
ctatgttgacacaaaattcagtgcttcaattacttttc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38055442 |
ctatgttgacacaaaattcagtgcttcaattacttttc |
38055479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University