View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_high_21 (Length: 238)
Name: NF8266_high_21
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 29 - 223
Target Start/End: Original strand, 43540008 - 43540202
Alignment:
| Q |
29 |
tacaaacaaaggtgcccatgaatacgtcattatatcaaatggatgttgaccgacaaatatgcattgtatcaaataccagaacttacctcctctactccat |
128 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43540008 |
tacaaacaaaggtgcccatgaatatgtcattatatcaaatggatgttgactgacaaatatgcatactatcaaataccagaacttacctcctctactccat |
43540107 |
T |
 |
| Q |
129 |
ctgtgtctgtaatgtctaaatatcctttgataagggagttgaaaactacaggatttggatgcactccaagctccttcattttgtatagaaatctc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540108 |
ctgtgtctgtaatgtctaaatatcctttgataagggagttgaaaactacaggatttggatgcactccaagctccttcattttgtatagaaatctc |
43540202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University