View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_low_16 (Length: 281)
Name: NF8266_low_16
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 50651352 - 50651614
Alignment:
| Q |
1 |
ataatatttggcattgattgagaagataattctgtcaaatcccagctcaatactccacaaaaatgcatctaacaaagcttttgcttctcccattcggact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651352 |
ataatatttggcattgattgagaagataattctgtcaaatcccagctcaatactccacaaaaatgcatctaacaaagcttttgcttctcccattcggact |
50651451 |
T |
 |
| Q |
101 |
gacatcaaaggttccaaccatagagtgttcactccgacaaacaaatcatctcgtccctaatacatattccaataccaactcattatgatgagag-agaga |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |
|
|
| T |
50651452 |
gacatcaaaggttccagccatagagtgttcactccgacaaacaaatcatctcgtccctaatacatattccaataccaactcattatgatgagagaaaaaa |
50651551 |
T |
 |
| Q |
200 |
aatgctggtagtacgacaccattgaatcaaactgctttgcttgagctgctacccttgggatca |
262 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651552 |
aatgctggtaggacgacaccattgaatcaaactgctttgcttgagctgctacccttgggatca |
50651614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University