View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_low_19 (Length: 250)
Name: NF8266_low_19
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 41127384 - 41127143
Alignment:
| Q |
1 |
tgtcttaatgttggtaaaacaacacattatggtaatgcatgccaatgttatactatttcatggtatggattcaacaaacttagaactgataggggaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127384 |
tgtcttaatgttggtaaaacaacacattatggtaatgcatgccaatgttatactatttcatggtatggattcaacaaacttagaactgataggggaagaa |
41127285 |
T |
 |
| Q |
101 |
aagtcatttgttacc----aactggtaatgtatcgtaagagtgatttaattatcaactggaacgtcttaacaactcacttttacacaagatattcacacc |
196 |
Q |
| |
|
||||||||||||||| || | | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41127284 |
aagtcatttgttaccaaataaattgaagagtatcgtaagagtgatttaattatcaactggaacgtcttaacaactcacttttacacaagatattcacacc |
41127185 |
T |
 |
| Q |
197 |
aatgccacgccctaagcttcctcgatcttctactttgattctt |
239 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
41127184 |
aatgccacggcctaagcttcctcgatcttcta-tttgattctt |
41127143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University