View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8266_low_21 (Length: 242)
Name: NF8266_low_21
Description: NF8266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8266_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 171
Target Start/End: Original strand, 46720447 - 46720600
Alignment:
| Q |
18 |
atttgttcaaaaatggcaacagatagcccgacttgaatgctgaatatgccaacctaaataaatacatgcataaaacattattgaccatttaatatgacac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46720447 |
atttgttcaaaaatggcaacagatagcccgacttgaatgctgaatatgccaacctaaataaatacatgcataagacattattgaccatttaatatgacac |
46720546 |
T |
|
| Q |
118 |
cacttctgcaacttgtcaattgacattcaaacatcagtacaccatgctgtgact |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46720547 |
cacttctgcaacttgtcaattgacattcaaacatcagtacaccatgctgtgact |
46720600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 46720625 - 46720689
Alignment:
| Q |
179 |
agacccaatcccacttgatgctttgcnnnnnnntgattattttcaacctctatt-aactaatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
46720625 |
agacccaatcccacttgatgctttgcaaaaaaatgattattttcaacctctattaaactaatctc |
46720689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University