View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8268_low_4 (Length: 283)
Name: NF8268_low_4
Description: NF8268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8268_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 11159551 - 11159304
Alignment:
| Q |
8 |
tttggtgttggatggctgtgaagatatatgttcaggtta-aattgcagccatgcaca--------ttgccacgactctccaacgtgtgctcttaggtgta |
98 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11159551 |
tttggtggtggatggctgtgaagatatattttcaggttacaattgcagccatgcacaattgcacattgccacgactctccaacgtgtgctcttaggtgta |
11159452 |
T |
 |
| Q |
99 |
actcaatggggatgacacatatcgtaaggattaaataaaagaggctacaagatacgagtatatgtgacccaacataaatcatattcatgttaggtcagac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11159451 |
actcaatggggatgacacatatcgtaaggattaaataaaagaggctacaagatacgagtatatgaaacccaacataaatcatattcatgttaggtcagac |
11159352 |
T |
 |
| Q |
199 |
tatttttaaaacaaataaagtcaagtttattttaagatgtctatttag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11159351 |
tatttttaaaacaaataaagtcaagtttattttaagatgtctatttag |
11159304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University