View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8269_high_7 (Length: 271)
Name: NF8269_high_7
Description: NF8269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8269_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 261
Target Start/End: Complemental strand, 48844519 - 48844272
Alignment:
| Q |
14 |
atgaaggccccaaaaactgtcaagtagcatttccacaactaatgcgtgaaccaaattattatttatatgacaatgnnnnnnnctatttaatttgttacag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48844519 |
atgaaggccccaaaaactgtcaagtagcatttccacaactaatgcgtgaaccaaattattatttatatgacaatgtttttttctatttaatttgttacag |
48844420 |
T |
 |
| Q |
114 |
ttcatatttgctactaacaatgggcatccaatgtgttgctacgaatcggtcttattcttaaatggccaccatctacacaggcagggacaaaaatgccaac |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48844419 |
ttcatattttctactaacaatgggcatccaatgtgttgctacgaatcggtcttattcttaaatggccaccatctacacaggcagggacaaaaatgccaac |
48844320 |
T |
 |
| Q |
214 |
actagaaacacaattagatttggctatgttgtacgagaaaactgatga |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48844319 |
actagaaacacaattagatttggctatgttgtacgagaaaactcatga |
48844272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University