View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8269_low_12 (Length: 324)
Name: NF8269_low_12
Description: NF8269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8269_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 29672854 - 29672564
Alignment:
| Q |
16 |
gaacaaaaacaacacaaatggaaccttctacaaaaagcagccgccaccgcccttgacttcgtcgaaacaaccttaatcaaacaagaacagaaacacccac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29672854 |
gaacaaaaacaacacaaatggaaccttctacaaaaagccgccgccaccgccctcgacttcgtcgaaacaaccttaatcaaacaagaacaaaaacacccac |
29672755 |
T |
 |
| Q |
116 |
taccaaaaacctccgacccacgtgtccaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggcaaaatccc |
215 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672754 |
tacccaaaacctccgacccacgtgttcaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggcaaaatccc |
29672655 |
T |
 |
| Q |
216 |
aaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttcttcgacggagacggtatg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672654 |
aaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttcttcgacggagacggtatg |
29672564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University