View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8269_low_15 (Length: 253)
Name: NF8269_low_15
Description: NF8269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8269_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 9439850 - 9440080
Alignment:
| Q |
16 |
tgaatatatatgactttgacaaagatattagttatggttgtggttatattgcttaaattgggtaaagtaatgtataataaattatgtcgtggtgtgcttt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9439850 |
tgaatatatataactttgacaaagatattatgtatggttgtggttatattgcttaaattgggtaaagtaatgtataataaaatatgtcgtggtgtgcttt |
9439949 |
T |
 |
| Q |
116 |
tctaaatatttaattttcgagttcttttgatgtaaatttatgtgagctaattcataaataggctctctcaacctctctatcacatatactacaaaatttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9439950 |
tctaaatatttaattttcgagttcttttgatgtaaatttatgtgagctaattcataaataggctctctcaacctctctatcacatatactacaagatttt |
9440049 |
T |
 |
| Q |
216 |
tacttggtttttctattgacttatttttctt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9440050 |
tacttggtttttctattgacttatttttctt |
9440080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University