View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8270_low_13 (Length: 317)
Name: NF8270_low_13
Description: NF8270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8270_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 39579727 - 39579577
Alignment:
| Q |
8 |
atgaagaacgattgctttttgacctaaatttaactacaataaaacaaaataaaagtctaaatatgctaaacttttgaagaaacatggctcaaataacaat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39579727 |
atgaagaacgattgctttttgacctaaatttaactacaataaaacaaaataaaagtctaaatatgctaaacttttgaagaaacatggttcaaataacaat |
39579628 |
T |
 |
| Q |
108 |
aacaagtcattaattaaccagtattaaatttacaatgtatgtatatctgtt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39579627 |
aacaagtcattaattaaccagtattaaatttacaatgtatgtatatctgtt |
39579577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 227 - 298
Target Start/End: Complemental strand, 39579508 - 39579436
Alignment:
| Q |
227 |
gatgaatcttacatacatgctaaaaacttt-aactacatctagaagatgtgaacatcctatttatatacacat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39579508 |
gatgaatcttacatacatgctaaaaacttttaactacatctagaagatgtgaacatcctatttatatatacat |
39579436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University