View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8270_low_17 (Length: 249)
Name: NF8270_low_17
Description: NF8270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8270_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 37372175 - 37372304
Alignment:
| Q |
8 |
atgagatggacatcactcaagaccgcaccaaaataatgttatgtacatacaaaacctataaattttgcattaaggaaataaatgagatggatggtagtca |
107 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37372175 |
atgacatggacctcactcaagaccgcaccaaaataatgttatgtacatacaagacctataaattttgcattaaggaaataaatgagatggatggttgtca |
37372274 |
T |
|
| Q |
108 |
aattaacagtggcaagtggagatttaggaa |
137 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
37372275 |
aattactagtggcaagtggagatttaggaa |
37372304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 156 - 249
Target Start/End: Original strand, 37372290 - 37372384
Alignment:
| Q |
156 |
gtggagatttaggaaaactacaagagaaaatattataaaa-ttttagagattgatgagttcgagaatgatgtgatatatgacataatattatagt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37372290 |
gtggagatttaggaaaactacaagagaaattattataaaagttttagagattgatgagttcgagagtgatgtgatatatgacataatattatagt |
37372384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University