View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8271_high_4 (Length: 274)
Name: NF8271_high_4
Description: NF8271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8271_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 263
Target Start/End: Original strand, 16946991 - 16947239
Alignment:
| Q |
15 |
gacatcacatagttgataaggtacacaattacagcaggtgcagctaggtaaaaaagtagcttaaattcaacccatgtagcaagtttaatacgtttcacaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16946991 |
gacatcacatagttgataaggtacacaattacagaaggtgcagctaggtaaaaaagtagcttaaattcaacccatgtagcaagtttaatacgtttcacaa |
16947090 |
T |
|
| Q |
115 |
aaggaacacttgtatctgagagtattctttcaagttcaccatctgattcatgctttgaaccaaatgaatgagtgaatgatgatagtagtattggtgttgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16947091 |
aaggaacacttgtatctgagagtattctttcaagttcaccatctgattcatgctttgaaccaaatgaatgagtgaatgatgataatagtattggtgttgg |
16947190 |
T |
|
| Q |
215 |
ttcacttggtagtagcaaaggttcatcaatatctttgtcaacatgagta |
263 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16947191 |
ttcactaggtactagtaaaggttcatcaatatctttgtcaacatgagta |
16947239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University