View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8271_low_5 (Length: 422)
Name: NF8271_low_5
Description: NF8271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8271_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 150 - 406
Target Start/End: Original strand, 1541327 - 1541597
Alignment:
| Q |
150 |
agtacatgtacacctttttacgatagctaggtggaacctatatttgtaacttctatattctactgaataatttttacag-ccatgaaacaaacaccgcct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1541327 |
agtacatgtacacctttttacgatagctaggtggaacctatatttgtaacttctatattctagtgaataatttttacaaaccatgaaacaaacaccgcct |
1541426 |
T |
|
| Q |
249 |
tacggtatcgtattcctacccagcatgttatctcatctcaatcatcaacggaagaaca-------------tagctcccctcttttgttttatgaatttt |
335 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1541427 |
tactgtatcgtattgctacccagcatgttatctcatctcaatcatcaacggaagaacatagctcatttttttagctcccctcttttgttttatgaatttt |
1541526 |
T |
|
| Q |
336 |
gttcaaatcatatagctaacttcatgtttttaaaccctttaatggatggtatctataaggaccttctttat |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||| |
|
|
| T |
1541527 |
gttcaaatcatatagctaacttcatgtttttaaaccctttaatgaatggtatctacaaagaccttctttat |
1541597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 89 - 152
Target Start/End: Original strand, 1541240 - 1541303
Alignment:
| Q |
89 |
tatcaatgcgaacatggttagtttcatgttgctttccaacacaagttttcattctttatggagt |
152 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1541240 |
tatcaatgtgaacatggttagtttcatgttgctttccaacacaagttttcattctttatggagt |
1541303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 24645942 - 24645864
Alignment:
| Q |
5 |
tttggtgttgtagttttgaatccaataacctaagtttctttttcataggacgatgtagattaatacttataacttcttt |
83 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24645942 |
tttggtgctgtagttttgaatccaataacctaggtttctttttcataggacgatgtagattaatacttataacttcttt |
24645864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University