View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8271_low_7 (Length: 309)
Name: NF8271_low_7
Description: NF8271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8271_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 2 - 259
Target Start/End: Complemental strand, 23332852 - 23332595
Alignment:
| Q |
2 |
aggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332852 |
aggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccct |
23332753 |
T |
|
| Q |
102 |
gacttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatg |
201 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332752 |
gacgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatg |
23332653 |
T |
|
| Q |
202 |
attgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacatat |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332652 |
attgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 254 - 296
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
254 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
296 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 254 - 296
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
254 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
296 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University