View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8272_high_6 (Length: 302)
Name: NF8272_high_6
Description: NF8272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8272_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 45 - 289
Target Start/End: Original strand, 23971851 - 23972095
Alignment:
| Q |
45 |
tgaaagagtaatttagacccacggggagcgctacactaatagtcttgtaagaacgtgagataatgtttgaggagaacttgactctagggtggaaacacat |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
23971851 |
tgaaagagtaatttagacccatggggagcgctacactaatagtcttgtaagaacgtgagataatgtttgaggagaacttgactctagagcggaaacacat |
23971950 |
T |
|
| Q |
145 |
tactaagctaaacatgtcaaggatgccttgccttgacgatgatcatcctctcttatgcttttttcaaaagagaatcgactgatgcgatattaatctcgca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| | | || |
|
|
| T |
23971951 |
tactaagctaaacatgtcaaggatgccttgccttgacgatgatcatcctctcttatgcttttttcaagagagaatcgagtgatgcgatattatgcccaca |
23972050 |
T |
|
| Q |
245 |
aggaatgaggagtttgaattatgcaggacaagttcatgctcatat |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23972051 |
aggaatgaggagtttgaattatgcaggacaagttcatgctcatat |
23972095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 8865595 - 8865549
Alignment:
| Q |
1 |
tccaggaaaaggaaaagtgcagctgcggagcttgaatagtttaatga |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8865595 |
tccaggaaaaggaaaagtgcagcggcggagcttgaatagtttaatga |
8865549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10893208 - 10893162
Alignment:
| Q |
1 |
tccaggaaaaggaaaagtgcagctgcggagcttgaatagtttaatga |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10893208 |
tccaggaaaaggaaaagtgcagcggcggagcttgaatagtttaatga |
10893162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 11127163 - 11127209
Alignment:
| Q |
1 |
tccaggaaaaggaaaagtgcagctgcggagcttgaatagtttaatga |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11127163 |
tccaggaaaaggaaaagtgcagcggcggagcttgaatagtttaatga |
11127209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University