View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8272_low_12 (Length: 258)
Name: NF8272_low_12
Description: NF8272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8272_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 107 - 243
Target Start/End: Complemental strand, 5689776 - 5689637
Alignment:
| Q |
107 |
agtggagaaataataagtggtttgatg---gattttgtaatggagatttttctttttgcataatgcttggaatgagtagttgtttgaatatgacaaggnn |
203 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5689776 |
agtggagaaataataagtggtttgatgattgattttgtaatggagatttttctttttgcataatgcttggtatgagtagttgtttgaatatgacaaggaa |
5689677 |
T |
|
| Q |
204 |
nnnnnntgatgcaaaagtaccttatggttgtcatcattga |
243 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |
|
|
| T |
5689676 |
aaaaaatgatgcaaaagtaccatgtggttgtcatcattga |
5689637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 5 - 79
Target Start/End: Complemental strand, 5689879 - 5689805
Alignment:
| Q |
5 |
ctgctgttgaagcttctcctgctgctaaggctcttgagcctcatgctgtcattgctggttttaccaattagttaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5689879 |
ctgctgttgaagcttctcctgctgctaaagctcttgagcctcatgctgtcattgctggttttacaaattagttaa |
5689805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 25914559 - 25914500
Alignment:
| Q |
9 |
tgttgaagcttctcctgctgctaaggctcttgagcctcatgctgtcattgctggttttac |
68 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
25914559 |
tgttgaagcttctcctgctgctaaagctcttgagccacatgctaccattgctggttttac |
25914500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University