View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8273_low_13 (Length: 333)
Name: NF8273_low_13
Description: NF8273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8273_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 26 - 317
Target Start/End: Complemental strand, 43034340 - 43034049
Alignment:
| Q |
26 |
ttggtgttgggtttggcctacagcttaaaagttaggggagtgattgcaattcatggtgttgttcgatccaattttgaatagaagatttgaactgcacaga |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
43034340 |
ttggtgttgggtttggcctacagcttaaaagttaggggagtgattgcaattcatggtgttgttcgatgcaagtttgaatagaagatttgaactgtacaga |
43034241 |
T |
 |
| Q |
126 |
aagattgaatgcaaatcatgttgatgatttcattgtcnnnnnnnnnnctttcctatttcaaatgtttagactgtgactttttatgttgcttccactgaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43034240 |
aagattgaatgcaaatcatgttgatgatttcattgtcttttttttttctttcctatttcaaatgtttagactgtgactttttatgttgcttccattgaat |
43034141 |
T |
 |
| Q |
226 |
ccatggaatagtttcaaaacaactgtatgtaaattttcatggttaagttcgttttcacacttctcaagaatgttgaagtgtctcacaaactt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034140 |
ccatggaatagtttcaaaacaactgtatgtaaattttcatggtttagttcattttcacacttctcaagaatgttgaagtgtctcacaaactt |
43034049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University