View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8273_low_15 (Length: 288)
Name: NF8273_low_15
Description: NF8273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8273_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 7595777 - 7596020
Alignment:
| Q |
15 |
atgaaggaattgaaggaaatatatttgcttccatatttaccaaaacagagaagctaaagcagaggattttatttatttttatcaagtaagtaaagtatag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7595777 |
atgaaggaattgaaggaaatatatttgcttccatatttaccaaaacagagaagctaaagcaggggattttatttttttttatcaagtaagtaaagtatag |
7595876 |
T |
 |
| Q |
115 |
taataataacnnnnnnnacatgcacgtgcacccaccctacatatataatttccatggaccacacgatagttatggatataaatgtatatgtacgtaccgt |
214 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7595877 |
taataataactttttttacatg----------taccctacatatataatttccatggaccacacgatagttatggatataaatgtatatgtacgtaccgt |
7595966 |
T |
 |
| Q |
215 |
agtgtcnnnnnnncgtggcgattgagtgaaggagtatgtaaagtgagagagatcag |
270 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7595967 |
agtgtcaaaaaaacgtggcgattgagtgaag--atatgtaaagtgagagagatcag |
7596020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University