View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8273_low_18 (Length: 228)
Name: NF8273_low_18
Description: NF8273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8273_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 22 - 212
Target Start/End: Original strand, 4016205 - 4016398
Alignment:
| Q |
22 |
ttttgtacctaattgcagtttaagagtgaacacataaattagtcctcaaaattataagaattgatcaaaattgtttttacttttgtgattagtaaataca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4016205 |
ttttgtacctaattgcagtttaagagtgaacacataaattagtcctcaaaattataagaattgatcaaaattgtttttacttttgtgattagtaaataca |
4016304 |
T |
|
| Q |
122 |
tttttaaaattgtaaaatgtcaatcaaatagta---ttannnnnnnnaactttttaagaatatgtccatatatacattaactgaatgtgttctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4016305 |
tttttaaaattgtaaaatgtcaatcaaatagtattttttattttttttactttttaagaatatgtccatatatacattaagtgaatgtgttctt |
4016398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University