View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8274_low_14 (Length: 204)
Name: NF8274_low_14
Description: NF8274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8274_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 54608253 - 54608157
Alignment:
| Q |
15 |
atatcaatctctaaagcaatgagaacaaatcaaaatcatttataggtgcaatttacaaaaagagtaacaaataaaaaatagtttttcaatgctaagc |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608253 |
atatcgatctctaaagcaatgagaacaaatcaaaatcatttataggtgcaatttacaaaaagagtaacaaataaaaaatagtttttcaatgctaagc |
54608157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 54607922 - 54607880
Alignment:
| Q |
153 |
gaggtgagaaaattacatgaggaagagttgagaagaataatat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54607922 |
gaggtgagaaaattacatgaggaagagttgagaagaataatat |
54607880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University