View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8275_low_4 (Length: 209)
Name: NF8275_low_4
Description: NF8275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8275_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 45281353 - 45281538
Alignment:
| Q |
18 |
acattggactgggatccgatgagagagaggaccttgatgatgtcagtttccctgcttgggtgtatgatctctagagagagtctacgtcatggtccacgtc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45281353 |
acattggacttggatccgatgagagagaggaccttgatgatgtcagtttccctacttgggtgtatgatctctagagagagtctacgtcatggtccgcgtc |
45281452 |
T |
 |
| Q |
118 |
gaagctagttacttgaggcaactcggtcccttaatcgattgggctttggcctaatccgaaacaaagcacttgatgtccatctcatt |
203 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||| || |||||| |
|
|
| T |
45281453 |
gaagctagttacttgaggcaactcagtcccttaatcgattgggctttggcctagtccgaaacaaagcactttatgttcaactcatt |
45281538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University