View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8277_low_4 (Length: 266)
Name: NF8277_low_4
Description: NF8277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8277_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 151
Target Start/End: Complemental strand, 30418837 - 30418700
Alignment:
| Q |
14 |
ttctgcttttcatgatactcagcttgtttgtagtggtgatcttgcttatttgggtggatcttggagcaaaaacgttggttgcgctgtaagtattcttttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418837 |
ttctgcttttcatgatactcagcttgtttgtagtggtgatcttgcttatttgggtggatcttggagcaaaaacgttggttgcgctgtaagtattcttttt |
30418738 |
T |
|
| Q |
114 |
tattcttatttttaatgttgttaggaaataggattagg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418737 |
tattcttatttttaatgttgttaggaaataggattagg |
30418700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 151 - 248
Target Start/End: Complemental strand, 30418677 - 30418580
Alignment:
| Q |
151 |
gagatcattttgattacctaatgtaatctattgttgattgtgaggatgcatttcttatattttagcaagcttaactaagcgttttaataggatatcat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418677 |
gagatcattttgattacctaatgtaatctattggtgattgtgaggatgcatttcttatattttagcaagcttaactaagcgttttaataggatatcat |
30418580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University