View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8279_high_11 (Length: 239)
Name: NF8279_high_11
Description: NF8279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8279_high_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 175274 - 175495
Alignment:
| Q |
18 |
ggaaatagtgaaatgatcaacgaagtgacggagaaggaaaacaagagaagcggtggaggcaatggattgaaggatatttgagaaagagtgagtggtggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175274 |
ggaaatagtgaaatgatcaacgaagtgacggagaaggaaaacgagagaagcggtggaggcaatggattgaaggatatttgagaaagagtgagtggtggaa |
175373 |
T |
|
| Q |
118 |
gcacgataccagagatgaaggaaagtggtgttgggatgatgagaagaaaagatgggagataggttatggatagcgatgatggatgatttggaacctaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
175374 |
gcacgataccagagatgaaggaaagtggtgttgggatgatgagaagaaaagatgggagataggttatggatagcgatgatggatgatttggaacctaaca |
175473 |
T |
|
| Q |
218 |
ttgcattcataaccaaacgaac |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
175474 |
ttgcattcataaccaaacgaac |
175495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University