View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8279_high_4 (Length: 406)
Name: NF8279_high_4
Description: NF8279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8279_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 259
Target Start/End: Complemental strand, 31160461 - 31160213
Alignment:
| Q |
8 |
gattattctcacggaaactgggtcattgatgatgatgattccactaccttctcctaccctctctatgatgcttcaaaagactgtcctttcattggtcaag |
107 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31160461 |
gattattctcaaggaaactgggtca---atgatgatgattccactaccttctcttaccctctctatgatgcttcaaaagactgtcctttcattggtcaag |
31160365 |
T |
 |
| Q |
108 |
gttttgattgtcttggaaatggtagaactgataaagattatatcaagtatagatggaagccctcgagatgtaattatccaaggtagttatttttgagtta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31160364 |
gttttgattgtcttggaaatggtagaactgataaagattatatcaagtatagatggaagccctcgagatgtaatcttccaaggtagttatatttgagtta |
31160265 |
T |
 |
| Q |
208 |
aagttttgttttttggaatgtatcttcaaatgggtagtcactaaagttcttg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31160264 |
aagttttgttttttggaatgtatcttcaaatgggtagtcactaaagttcttg |
31160213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 61 - 165
Target Start/End: Original strand, 50126830 - 50126934
Alignment:
| Q |
61 |
ctaccctctctatgatgcttcaaaagactgtcctttcattggtcaaggttttgattgtcttggaaatggtagaactgataaagattatatcaagtataga |
160 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| || | || || ||| ||||||| ||||||| ||| | ||| |||||||| |||| |||||| |
|
|
| T |
50126830 |
ctaccctctttatgatgcctcaagggactgtccttttatagtgcagggatttaattgtctcagaaatgggagaccagatcaagattatctcaaatataga |
50126929 |
T |
 |
| Q |
161 |
tggaa |
165 |
Q |
| |
|
||||| |
|
|
| T |
50126930 |
tggaa |
50126934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University