View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8279_high_9 (Length: 239)

Name: NF8279_high_9
Description: NF8279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8279_high_9
NF8279_high_9
[»] chr1 (1 HSPs)
chr1 (18-182)||(32773143-32773307)
[»] chr4 (1 HSPs)
chr4 (18-50)||(9938247-9938279)
[»] chr5 (1 HSPs)
chr5 (99-157)||(30789595-30789653)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 32773307 - 32773143
Alignment:
18 tttagcaagatgcttaagtgaagaagatgcttatgtggctttggttaaagtacatgacggtatggaaaatgaattgggaaatggaaaacaatttttccag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32773307 tttagcaagatgcttaagtgaagaagatgcttatgtggctttggttaaagtacatgacggtatggaaaatgaattgggaaatggaaaacaatttttccag 32773208  T
118 ttgatactaaaactcgaggatttgggaaatggtccccaaattaggaagggcctttcgtcattgag 182  Q
    ||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||    
32773207 ttgatactaaaactcgaggatctgggaaatggttcccgaattaggaagggcctttcgtcattgag 32773143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 9938247 - 9938279
Alignment:
18 tttagcaagatgcttaagtgaagaagatgctta 50  Q
    |||||||||||||||||||||||||||||||||    
9938247 tttagcaagatgcttaagtgaagaagatgctta 9938279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 157
Target Start/End: Complemental strand, 30789653 - 30789595
Alignment:
99 tggaaaacaatttttccagttgatactaaaactcgaggatttgggaaatggtccccaaa 157  Q
    ||||||||||  ||||||||| | |||||||||||||||||| | |||||||| |||||    
30789653 tggaaaacaaaatttccagttaacactaaaactcgaggatttagaaaatggtcgccaaa 30789595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University