View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8279_low_11 (Length: 239)
Name: NF8279_low_11
Description: NF8279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8279_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 32773307 - 32773143
Alignment:
| Q |
18 |
tttagcaagatgcttaagtgaagaagatgcttatgtggctttggttaaagtacatgacggtatggaaaatgaattgggaaatggaaaacaatttttccag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773307 |
tttagcaagatgcttaagtgaagaagatgcttatgtggctttggttaaagtacatgacggtatggaaaatgaattgggaaatggaaaacaatttttccag |
32773208 |
T |
|
| Q |
118 |
ttgatactaaaactcgaggatttgggaaatggtccccaaattaggaagggcctttcgtcattgag |
182 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
32773207 |
ttgatactaaaactcgaggatctgggaaatggttcccgaattaggaagggcctttcgtcattgag |
32773143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 9938247 - 9938279
Alignment:
| Q |
18 |
tttagcaagatgcttaagtgaagaagatgctta |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9938247 |
tttagcaagatgcttaagtgaagaagatgctta |
9938279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 157
Target Start/End: Complemental strand, 30789653 - 30789595
Alignment:
| Q |
99 |
tggaaaacaatttttccagttgatactaaaactcgaggatttgggaaatggtccccaaa |
157 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||| | |||||||| ||||| |
|
|
| T |
30789653 |
tggaaaacaaaatttccagttaacactaaaactcgaggatttagaaaatggtcgccaaa |
30789595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University