View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8279_low_9 (Length: 259)
Name: NF8279_low_9
Description: NF8279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8279_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 40652595 - 40652362
Alignment:
| Q |
9 |
attattctctttgtagttatggcgactcaaaaaattatgaacttataaatcnnnnnnntgaaaatcatagacattgaggatatggagaggatctt-aact |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40652595 |
attattctctttgtagttatggcaactcaaaaaattatgaacttataaataaaaaaaatgaaaatcatagacattgaggatatggagaggatctttaact |
40652496 |
T |
 |
| Q |
108 |
ccaattcaattttcaatttcattttatcaatgaaattaaatcgagtattgaatattcaattcaacacaaaacattcaagatcagtaattataagggaatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40652495 |
ccaattcaattttcaatttcattttatcaatgaaattaaatcgagtattgaatattcaattcaacacaaaacattcaagatcagtaattataagggaatg |
40652396 |
T |
 |
| Q |
208 |
aggaagagaatgtacgtggtggtggggcgcatag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40652395 |
aggaagagaatgtacgtggtggtggggcgcatag |
40652362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University