View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8281_low_8 (Length: 301)
Name: NF8281_low_8
Description: NF8281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8281_low_8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 301
Target Start/End: Original strand, 32016550 - 32016844
Alignment:
| Q |
17 |
ggaagttgagatttgaggatgatggagtcatttcggtaagctcagtgtacaaggtgttggaggggttgttaattttagaggatggtttgaatcctgtgga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32016550 |
ggaagttgagatttgaggatgatggagtcatttcggtaagctcaatgtacaaggtgttggaggggttgttaattttagaggatggtttgaatccggtgga |
32016649 |
T |
|
| Q |
117 |
ggaaaaggtgtttgattacttttggaaaagcccggccccgtcaaaagttgtggctttttcttg----------cgtgatcggattcctacgggaggaatc |
206 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||| |
|
|
| T |
32016650 |
ggaagaggtgtttggttacctttggaaaagcccagccccgtcaaaagttgtggctttttcttggaaacttcttcgtaatcggattcctacaggagaaatc |
32016749 |
T |
|
| Q |
207 |
ttgccattcagaatttattggacccgaaaagttcgaccaattgtgttttttgcgatgcttaggtagaatcttcaacgcatcttttcttgcattgt |
301 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32016750 |
ttgccattcagaatttattggatccgaaaagttcgaccaattgtgttttttgcgatgcttcggtagaatcttcaacacatattttcttgcattgt |
32016844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 180
Target Start/End: Original strand, 7425062 - 7425105
Alignment:
| Q |
137 |
tttggaaaagcccggccccgtcaaaagttgtggctttttcttgc |
180 |
Q |
| |
|
||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7425062 |
tttggaagagcccggctcggtcaaaagttgtggctttttcttgc |
7425105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University