View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8282_high_1 (Length: 347)
Name: NF8282_high_1
Description: NF8282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8282_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 36030982 - 36030700
Alignment:
| Q |
16 |
gtttggagtgaaaaagatcaaagattctaagtttaaggaagttggatgagtgagccagaagcgtggatttagcgacaattaagtggagtaggacttaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36030982 |
gtttggagtgaaaaagatcaaagattctaagtttaaggaagttggatgagtgagccagaagcgtggatttagcgacaattaagtggagtaggacttaaag |
36030883 |
T |
 |
| Q |
116 |
atttgctaaccatgccattagcgagctagaagcgaatcaagtcagagatttagaggtatttagaggtatttagagcagttcgctaagggagcaacatttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
36030882 |
atttgctaaccatgccattagcgagctagaagcgaatcaagtcagagatttagaggtattt---tgcaaagagagcagttcgctaagggagcaacatttt |
36030786 |
T |
 |
| Q |
216 |
gcttagcaaatttatggtggttgaataaccttatggatgatttg-ttagttatgttcctttgaagaaacatcaatttgctaagcga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36030785 |
gcttagcaaatttatggtggttgaataaccttatggatgatttgtttagttatgttcctttgaagaaacatccatttgctaagcga |
36030700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 36030518 - 36030472
Alignment:
| Q |
301 |
ttgtaatttatgcataatttgtgttttaaaacctttcagccaatgtc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36030518 |
ttgtaatttatgcataatttgtgttttaaaaccattcagccaatgtc |
36030472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University