View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8282_high_2 (Length: 326)
Name: NF8282_high_2
Description: NF8282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8282_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 106 - 320
Target Start/End: Original strand, 47713095 - 47713309
Alignment:
| Q |
106 |
aaaagagaagcttttcttttctcatctctcttagccctcgccgcagccttcgccgcatccctcaccgcaatctcttcactcatcaaagagtcttcatcgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47713095 |
aaaagagaagcttttcttttctcatctctcttggccctcgccgcagccttcgccgcatccctcaccgcaatctcttcactcatcaaagagtcttcatcag |
47713194 |
T |
 |
| Q |
206 |
tataatcgtgaagtaccgaaaaggggttttggattttcttaaccggagggggtttaacttgaaccaaagggggtttaaactcccattgttcttgatcgaa |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47713195 |
tataatcgtgaagtaccgaaaaggggttttggattttcttaaccagagggggtttaacttgaaccaaagggggtttaaactcccattgttcttgatcgaa |
47713294 |
T |
 |
| Q |
306 |
ttttctaacaccaaa |
320 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
47713295 |
ttttcttacaccaaa |
47713309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University