View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8283_high_10 (Length: 300)
Name: NF8283_high_10
Description: NF8283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8283_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 42780673 - 42780956
Alignment:
| Q |
1 |
cttcaatacccgcctgcactcaactatttgtaaccaagcctcggttatgaacttaagctctgcttcagcttggcactgtgcgtcacgaagcttctctata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780673 |
cttcaatacccgcctgcactcaactatttgtaaccaagcctcggttatgaacttaagctctgcttcagcttggcactgtgcgtcacgaagcttctctata |
42780772 |
T |
|
| Q |
101 |
tgaaccgtttgcatctggtgtagatcagcaagagctttttgccttgaagattggttgctagcccaccgctcataataatgtgtatacctctccaataaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780773 |
tgaaccgtttgcatctggtgtagatcagcaagagctttttgccttgaagattggttgctagcccaccgctcataataatgtgtatacctctccaataaat |
42780872 |
T |
|
| Q |
201 |
tctttgccatttctcttcttttttcagtttcatcataatccccctttaatttagagttttcataacgattgcaagcgtcgtaac |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780873 |
tctttgccatttctcttcttttttcagtttcatcataatccccctttaatttagagttttcataacgattgcaagcgtcgtaac |
42780956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 29539169 - 29538933
Alignment:
| Q |
1 |
cttcaatacccgcctgcactcaactatttgtaaccaagcctcggttatgaacttaagctctgcttcagcttggcactgtgcgtcacgaagcttctctata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||| |||||||||| ||||| ||| ||||| ||| |
|
|
| T |
29539169 |
cttcaatacccgcctgcactcaactatctgtaaccaagcctcggttatgaacttaagctgcgactcaggttggcactgtatgtcactaagattctccata |
29539070 |
T |
|
| Q |
101 |
tgaaccgtttgcatctggtgtagatcagcaagagctttttgccttgaagattggttgctagcccaccgctcataataatgtgtatacctctccaataaat |
200 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| || ||||| | | |
|
|
| T |
29539069 |
tgaacagtttgcatctggtgtagatcagtaagagctttttgccttgaagattggtttgtagcccaccgctcataataatgtgtgtacttcaccaatgatt |
29538970 |
T |
|
| Q |
201 |
tctttgccatttctcttcttttttcagtttcatcata |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29538969 |
tctttgccatttctcttcttttttcagtttcatcata |
29538933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 29554014 - 29553781
Alignment:
| Q |
1 |
cttcaatacccgcctgcactcaactatttgtaaccaagcctcggttatgaacttaagctctgcttcagcttggcactgtgcgtcacgaagcttctctata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| || |||| |||||||||| | ||| |||||||| ||| |
|
|
| T |
29554014 |
cttcaatacccgcctgcactcaactatctgtaaccaagcctcggtaatgaacttaagctgtgactcaggttggcactgtatgacactaagcttcttcata |
29553915 |
T |
|
| Q |
101 |
tgaaccgtttgcatctggtgtagatcagcaagagctttttgccttgaagattggttgctagcccaccgctcataataatgtgtatacctctccaataaat |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||| ||| |||||||||| | |
|
|
| T |
29553914 |
tgaacagtttgcatctggtgtagatcagcaagagctttttgccttgaagaattgttactagcccaccgctcataataatgtgcgtacttctccaataatt |
29553815 |
T |
|
| Q |
201 |
tctttgccatttctcttcttttttcagtttcatc |
234 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |
|
|
| T |
29553814 |
tctttgccatttctcttctaattacagtttcatc |
29553781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 148 - 237
Target Start/End: Complemental strand, 42191908 - 42191819
Alignment:
| Q |
148 |
agattggttgctagcccaccgctcataataatgtgtatacctctccaataaattctttgccatttctcttcttttttcagtttcatcata |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42191908 |
agattggttgctagcccaccgctcataataatgtgtgtacctctccaatgaattctttgccatttctcttcttttttcagtttcatcata |
42191819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 100 - 147
Target Start/End: Complemental strand, 42192112 - 42192065
Alignment:
| Q |
100 |
atgaaccgtttgcatctggtgtagatcagcaagagctttttgccttga |
147 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42192112 |
atgaacagtttgcatctggtgtagatcagcaagagctttttgccttga |
42192065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 29 - 96
Target Start/End: Complemental strand, 42193193 - 42193126
Alignment:
| Q |
29 |
tgtaaccaagcctcggttatgaacttaagctctgcttcagcttggcactgtgcgtcacgaagcttctc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| | || |||| |||||| |||| ||||| ||||||||| |
|
|
| T |
42193193 |
tgtaaccaagcctcggttatgaacttaagttgtgactcaggttggcattgtgtgtcactaagcttctc |
42193126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 148 - 237
Target Start/End: Complemental strand, 25209356 - 25209267
Alignment:
| Q |
148 |
agattggttgctagcccaccgctcataataatgtgtatacctctccaataaattctttgccatttctcttcttttttcagtttcatcata |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || || ||||||||| ||||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
25209356 |
agattggttgctggcccaccgctcataataatgggtgtatctctccaatgaattcttcgccatttctcttcttctttcagtatcatcata |
25209267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University