View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8283_high_13 (Length: 225)

Name: NF8283_high_13
Description: NF8283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8283_high_13
NF8283_high_13
[»] chr3 (1 HSPs)
chr3 (16-211)||(2627588-2627783)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 2627783 - 2627588
Alignment:
16 agatggagggagattattgtcttgcgtagtaatgcagaggtatgttcatgtggtgcagcagtgtgtcatgagtggacatgattgctcgactggatcatcg 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
2627783 agatggagggagattattgtcttgcgtagtaatgcagaggtatgttcatgtggtgcagcagtgtgtcatgagtggacatgattgctcgaccggatcatcg 2627684  T
116 ctgaaagagtgaacaatactgtcttcacgagttggatgggaatgatggcaggggtggtttggttggcagggaagcatttagatggagcaaagaagt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2627683 ctgaaagagtgaacaatactgtcttcacgagttggatgggaatgatggcaggggtggtttggttggcagggaagcatttagatggagcaaagaagt 2627588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University