View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8284_high_10 (Length: 299)
Name: NF8284_high_10
Description: NF8284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8284_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 22 - 145
Target Start/End: Complemental strand, 30652709 - 30652586
Alignment:
| Q |
22 |
agaaattttagaagtggtgctgggtggaaaacaatcaaagggctcctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652709 |
agaaattttagaagtggtgctgggtggaaaacaatcaaagggcttctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaa |
30652610 |
T |
 |
| Q |
122 |
gaaggaaacaaatgacaaccacgt |
145 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30652609 |
gaaggaaacaaatgacaaccacgt |
30652586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 203 - 288
Target Start/End: Complemental strand, 30652524 - 30652439
Alignment:
| Q |
203 |
cctcatcaaagagctaagtacaaacggttacacatttccaaaatccaaatgactacttccttgattttcttctgctttcttctctc |
288 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652524 |
cctcatcaaagagctaagcacaaacggttacacatttccaaaatccaaatgactacttccttgattttcttctgctttcttctctc |
30652439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University