View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8284_high_5 (Length: 401)
Name: NF8284_high_5
Description: NF8284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8284_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 124 - 326
Target Start/End: Complemental strand, 14831520 - 14831318
Alignment:
| Q |
124 |
atctagacatgttgtgttttatgaaaacatgtttccgtttcataacaaagatacttctatgttacaaaatagtaattctcaaattcacttgcctaccgct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14831520 |
atctagacatgttgtgttttatgaaaacatgtttccgtttcataacaaagaaacttctatgttacaaaatagtaattctcaaattcacttgcctaccgct |
14831421 |
T |
 |
| Q |
224 |
tgtccgtttctaattcttttttatttatcttgtgacaatgatgaccatgacattgatagtaatgtagctataattcattttgctaagcataataatattc |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14831420 |
tgtccgtttctaattcttttttatttatcttgtcacaatgatgaccatgacattgatagtaatgtagctataattcattttgctaagcataataatatcc |
14831321 |
T |
 |
| Q |
324 |
att |
326 |
Q |
| |
|
||| |
|
|
| T |
14831320 |
att |
14831318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 124 - 193
Target Start/End: Original strand, 14831744 - 14831813
Alignment:
| Q |
124 |
atctagacatgttgtgttttatgaaaacatgtttccgtttcataacaaagatacttctatgttacaaaat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14831744 |
atctagacatgttgtgttttatgaaaacatgtttccgtttcataacaaagaaacttctatgttacaaaat |
14831813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 332 - 394
Target Start/End: Complemental strand, 14831222 - 14831160
Alignment:
| Q |
332 |
tttgattgtcatcatgtttgtgagaaaatccaatatgataatattcatttactttccatctct |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14831222 |
tttgattgtcatcatgtttgtgagaaaatccaatatgataatattcatttactttctatctct |
14831160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University