View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8284_low_14 (Length: 264)

Name: NF8284_low_14
Description: NF8284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8284_low_14
NF8284_low_14
[»] chr6 (1 HSPs)
chr6 (19-164)||(33652380-33652528)
[»] chr8 (1 HSPs)
chr8 (38-149)||(4365461-4365576)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 19 - 164
Target Start/End: Original strand, 33652380 - 33652528
Alignment:
19 aaatagtaccaaccagaattttctgcaaaactatccat---ttaaaaccatgaatgatattaaaacgaaatcaaacatttttgtagaatttattagaaat 115  Q
    ||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||    
33652380 aaatagtaccaaccagaattttctgcaaaactatccatcagttaaaaccatgaatgatattaaaacgaaatcaaacatttttgtagaatttactagagat 33652479  T
116 aaccaattagcatacgaaggcgatgcaattggtcccatatcattgaata 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
33652480 aaccaattagcatacgaaggcgatgcaattggtcccatatcattgaata 33652528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 38 - 149
Target Start/End: Original strand, 4365461 - 4365576
Alignment:
38 tttctgcaaaactatccat---ttaaaaccatgaatgatat-taaaacgaaatcaaacatttttgtagaatttattagaaataaccaattagcatacgaa 133  Q
    ||||||||||||||||| |   ||||||||||||||||||| ||||| |||||||||||||| ||||||||||||| || ||||||||||| ||||||||    
4365461 tttctgcaaaactatccttcaattaaaaccatgaatgatatgtaaaatgaaatcaaacatttctgtagaatttattggagataaccaattaacatacgaa 4365560  T
134 ggcgatgcaattggtc 149  Q
    || |||||| ||||||    
4365561 ggagatgcagttggtc 4365576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University